187.

Repeated DNA Sequences

Medium

The DNA sequence is composed of a series of nucleotides abbreviated as 'A', 'C', 'G', and 'T'. For example, "ACGAATTCCG" is a DNA sequence. When studying DNA, it is useful to identify repeated sequences within the DNA. Given a string s that represents a DNA sequence, return all the 10-letter-long sequences (substrings) that occur more than once in a DNA molecule. You may return the answer in any order. Example 1: Input: s = "AAAAACCCCCAAAAACCCCCCAAAAAGGGTTT" Output: ["AAAAACCCCC","CCCCCAAAAA"] Example 2: Input: s = "AAAAAAAAAAAAA" Output: ["AAAAAAAAAA"] Constraints: 1 <= s.length <= 105 s[i] is either 'A', 'C', 'G', or 'T'.